User Upload

Inspired by the CompMotifs philosophy of building tools to accelerate interdisciplinary science, TM-SmiRs provides an easily accessible interface to utilise the package. Users can upload a file with target microRNA sequences to screen for secondary structre. The inputSmall.xlsx file in inputs/inputSmall.xlsx may be used as template. Two columns are required: full miRNA and sequence. The first column should contain the full microRNA name (e.g. hsa-miR-21-5p), and the second column the microRNA sequence (e.g. UAGCUUAUCAGACUGAUGUUGA).

  Temp (°C):